this post was submitted on 23 Jul 2023
423 points (94.3% liked)

Memes

51419 readers
663 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 6 years ago
MODERATORS
 

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

top 12 comments
sorted by: hot top controversial new old
[–] [email protected] 19 points 2 years ago (1 children)

Ugh it didn't blast or translate

EMBOSS_001_1
NVIALPVGTX
EMBOSS_001_2
TS
PDYQVLX
EMBOSS_001_3
RHSLITSRY

EMBOSS_001_4
STYW*SGYDV
EMBOSS_001_5
YLLVIRLRX
EMBOSS_001_6
LVPTGNQAMTX

[–] [email protected] 3 points 2 years ago (2 children)

Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?

[–] [email protected] 10 points 2 years ago

If "reading" the sequence, it sounds similar to Mr Krab's laugh

[–] [email protected] 7 points 2 years ago

Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help

[–] [email protected] 6 points 2 years ago (2 children)

I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.

[–] [email protected] 10 points 2 years ago (3 children)

If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences

Wikipedia: Human genome#Information content

[–] [email protected] 4 points 2 years ago

ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you

[–] [email protected] 2 points 2 years ago (1 children)

There is also epigenetic modifications to be considered

[–] [email protected] 1 points 2 years ago

Oh cool I didn't know that stuff, it's super interesting

[–] [email protected] 0 points 2 years ago

It bottles the mind.

[–] [email protected] 5 points 2 years ago

The future of onlyfans products

[–] [email protected] 6 points 2 years ago

Only 3 billion short