An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"
this post was submitted on 23 Jul 2023
423 points (94.3% liked)
Memes
51447 readers
833 users here now
Rules:
- Be civil and nice.
- Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.
founded 6 years ago
MODERATORS
you are viewing a single comment's thread
view the rest of the comments
view the rest of the comments
ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you